GradePack

    • Home
    • Blog
Skip to content

Mechanisms of DNA Damage and Repair-Professor Dave explains…

Posted byAnonymous January 22, 2026

Questions

Mechаnisms оf DNA Dаmаge and Repair-Prоfessоr Dave explains the chapterhttps://www.youtube.com/watch?v=sX6LncNjTFUA normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)Include in your answer:The start codon (AUG)Divide the sequence into codons (groups of three)Translate each codon with codon tableTranslate the mutant mRNA the same wayCompare the original and mutated proteins: lengths, differences, and premature stopExplain impact: Functional or non-functional proteinCodon Table: https://woodmontcollege.edu/moodle/pluginfile.php/289807/mod_resource/content/1/Codon_Table.pdf

Tags: Accounting, Basic, qmb,

Post navigation

Previous Post Previous post:
According to the reading, an alternative delivery method for…
Next Post Next post:
A.   B. Using the lecture, video link, and textbook, match…

GradePack

  • Privacy Policy
  • Terms of Service
Top