GradePack

    • Home
    • Blog
Skip to content
bg
bg
bg
bg

Author Archives: Anonymous

What are the major post-transcriptional modifications that h…

What are the major post-transcriptional modifications that happen to eukaryotic RNA before it is released as mRNA? (Mark all that apply.)

Read Details

Chloroplasts have their own DNA. Which other organelle in a…

Chloroplasts have their own DNA. Which other organelle in a plant cell has its own DNA?

Read Details

Leaves absorb the least amount of light in the ________ rang…

Leaves absorb the least amount of light in the ________ range of the visible spectrum.

Read Details

Here is a guide to what the following diagram means: K and…

Here is a guide to what the following diagram means: K and L are both strands of double-stranded DNA. A, B, C, and D represent mRNA transcripts. E, F, J, and G are specific locations along strand K/L. H and I don’t refer to DNA at all; they refer to directions (the direction that the arrow is pointing).  Where would the start codon be located along strand K/L? Image Description (Starting at the top and going down.) H with an arrow to the left and I with an arrow to the right. Double-stranded DNA: K GCCGTA(E)TAATGCATA(F)CATCA(J)TGCGACTTAGGGTTTCT(G)AAGTCAACAGTTATT K L CGGCAT(E)ATTACGTAT(F)GTAGT(J)ACGCTGAATCCCAAAGA(G)TTCAGTTGTCAATAA L mRNA transcripts: A GCCGUAUAAUGCAUACAUCAUGCGACUUAGGGUUUCUAAGUCAACAGUUAUU B CGGCAUAUUACGUAUGUAGUACGCUGAAUCCCAAAGAUUCAGUUGUCAAUAA C UUAUUGACAACUGAAUCUUUGGGAUUCAGCGUACUACAUACGUAAUAUGCCG D AAUAACUGUUGACUUAGAAACCCUAAGUCGCAUGAUGUAUGCAUUAUACGGC

Read Details

An individual is born with a mutation such that they cannot…

An individual is born with a mutation such that they cannot form MAC proteins that associate with one another in a plasma membrane. This is an example of ________.

Read Details

In the context of meiosis, homologous chromosomes can be def…

In the context of meiosis, homologous chromosomes can be defined as ________.

Read Details

Paralytic shellfish syndrome can cause ___ due to saxitoxin,…

Paralytic shellfish syndrome can cause ___ due to saxitoxin, a potent neurotoxin. 

Read Details

Which of the following accurately describes the path travell…

Which of the following accurately describes the path travelled by a new protein as it is synthesized and released from the cell?

Read Details

What is genetic drift? 

What is genetic drift? 

Read Details

______________ are comprised on microtubules and facilitate…

______________ are comprised on microtubules and facilitate bacterial phototaxis or chemotaxis.

Read Details

Posts pagination

Newer posts 1 … 29,383 29,384 29,385 29,386 29,387 … 82,663 Older posts

GradePack

  • Privacy Policy
  • Terms of Service
Top