Regarding coronaviruses, the emerging strains of the 21st century are likely to have originated in bat populations in the wild.

Starting with a single strand of plus sense RNA as the template, the final product of the HIV virus reverse transcriptase enzyme is

Regarding Streptococcus phylogeny and nomenclature, which of the following is true?

True or False. When a person has ” an antibiotic-resistant infection” it is because that person has previously taken antibiotics.

Bacterial exotoxins are typically

Below is a figure of the phylogenetic relationships between a group of coronaviruses. In the figure, coronaviruses that infect human beings and cause the common cold are highlighted in orange, and human-infecting SARS viruses are highlighted in red. Figure is from Nature Microbiology 5: 536–544(2020).   Based on this data, Is the following statement True or False? The closest relative to MERS-CoV is EriCoV.

True/False. The main reservoir for Staphylococcus aureus within the human body is the skin.

True/False. The main reservoir for Staphylococcus aureus in the human body is the oral tract, particularly the oropharynx.

True/False. It would likely be more difficult to completely eradicate a pathogen with an environmental reservoir than to eradicate a pathogen with a human-only reservoir.

Consider the following mRNA sequence, where the underlined AUG indicates a start codon for translation:  5′ AAAAUGGUCCUCGGCUCGCUAUCA 3′ When the GGC codon is in the A site, what codon will be in the P site? For your answer, write only the codon in the blank, written from 5′ to 3′ direction, but do NOT add 5′ or 3′ or any punctuation. So your answer should just be something like : GGG