GradePack

    • Home
    • Blog
Skip to content
bg
bg
bg
bg

GradePack

Which type of mutation changes a single amino acid in a tran…

Which type of mutation changes a single amino acid in a translated polypeptide?

Read Details

The bacterial genes that encode repressor proteins are somet…

The bacterial genes that encode repressor proteins are sometimes near to and sometimes distant from the operons they regulate. Why are they able to function in either case?

Read Details

During translation elongation, one end of the growing polype…

During translation elongation, one end of the growing polypeptide chain emerges from the ribosome while the other is attached to a tRNA. Which end of the polypeptide emerges?

Read Details

Shown is a gene being simultaneously transcribed by multiple…

Shown is a gene being simultaneously transcribed by multiple RNA polymerase enzymes. Where is the location of this gene’s promoter?

Read Details

Which of the following statements about transcription is NOT…

Which of the following statements about transcription is NOT true?

Read Details

Despite having ~20,000 protein coding genes, translation in…

Despite having ~20,000 protein coding genes, translation in human cells produces ~100,000 polypeptides. How is this possible?

Read Details

Based on the provided genetic code and your knowledge about…

Based on the provided genetic code and your knowledge about the initiation and termination of translation, what would be the second and last amino acids of the polypeptide produced from the mRNA shown below?5’ CCCUCGAUGGUCUUAGCGUAGCGCU 3’

Read Details

Which of the following indicates the relative rates of trans…

Which of the following indicates the relative rates of transcription of the lac operon for E. coli with access to abundant source(s) of the following of sugar(s): lactose only, glucose only, lactose and glucose. To be clear, transcription rates in answers are as highest > intermediate > lowest.

Read Details

The transcript produced from an operon is ______.

The transcript produced from an operon is ______.

Read Details

The most common problem created by a mutation that duplicate…

The most common problem created by a mutation that duplicates a portion of a chromosome is ________.

Read Details

Posts pagination

Newer posts 1 … 24,644 24,645 24,646 24,647 24,648 … 97,126 Older posts

GradePack

  • Privacy Policy
  • Terms of Service
Top