Them image below shows a protein purification using affinity chromatography. 1) What kind of resin is most likely of being used in this image? 2) Explain what is happening in steps 2, 3, and 4.

  Three different PCR reactions using a primer set with a perfect Tm of 50 C were performed. The expected product of each PCR was 1000 bp. The products obtained in each separate reaction were analyzed by electrophoresis. The results observed in the gel are depicted in the Figure. Which of the thermocycler programs described below was more likely used to obtain the results observed in Line 2; Line 3 and Line 4. The line 1 correspond to the molecular weight marker.  

E. coli transformation: Why do the cells, after transformation with the plasmid, need to be incubated for 45 min to 60 minutes in SOB/SOC or LB media without antibiotics?

After completing all experiments proposed in the advanced microbiology lab, you have now gained the ability to clone a gene using competent cells and express/purify proteins. List all steps involved in the cloning of alpha amylase from Bacillus subtilis using DH5 alpha and BL21 competent cell, including protein purification (just one sentence per step).

After growing the transformed DH5 alpha cells in LB + sucrose plate, we then use the colonies present in this media for the second plasmid extraction. Why we don’t digest the plasmid again in this step?

Design a reverse primer for the following sequence. The primer should be 18b long, typed with capital letters in the conventional way, no spaces between letters. ATCTGTAGATGTAGATGTCAGAGAAAAATGAGACAGATAGATGATGACACAGGATAG

The pCrazy45 was used to clone the alpha amylase gene. The plasmid map carrying the alpha amylase encoding the ORF correctly inserted downstream of the T7P is shown in the picture below. Describe the results you expect to have in agar plates having just LB sucrose 5% to recover the Escherichia coli colonies after transformation? The red circle with a line represents the T7 terminator.

Globally, 1 in ______ women and 1 in _____ men will develop cancer in their lifetime.

Final Exam Prompt: For your final exam, you will write to demonstrate your ability to summarize academic articles, synthesize information from multiple sources, use MLA documentation, organize your ideas clearly, and maintain an academic tone. Prompt:Read the following two articles about the impact of social media on the mental health of teenagers and young adults. Your task is twofold: First Paragraph: Summarize the main arguments and key findings of each article in your own words, making sure to attribute ideas clearly and use MLA in-text citations. Stay in an academic tone. Second Paragraph: Synthesize the information from both articles to develop your own argument about the effects of social media on young people’s mental health. Discuss how the articles agree, differ, or complicate each other, and explain how your own position draws on their ideas. You must use both PARAPHRASING AND QUOTING with parenthetical in-text citations in MLA format. This is not a personal experience or opinion piece; therefore, do not draw on your own experiences or beliefs. Articles for Support: (click the links provided with the citations) Stoney Brooks, Does personal social media usage affect efficiency and well-being?, Computers in Human Behavior, Volume 46, 2015, Pages 26-37, ISSN 0747-5632, https://doi.org/10.1016/j.chb.2014.12.053.Twenge, Jean M. “Have Smartphones Destroyed a Generation?” The Atlantic, Sept. 2017, https://www.theatlantic.com/magazine/archive/2017/09/has-the-smartphone-destroyed-a-generation/534198/. Bandekar, Bhairavi, et al. “Social Media: Effect, Affect, Teens, and Possible Addiction.” Digital Commons Collin, digitalcommons.collin.edu/ccuisrc/2018/thursday/2/. click “download” on the page to access pdf. Requirements: Summarize both articles accurately and concisely, using MLA in-text citations. Synthesize the information from both sources to present your own clear, arguable thesis. Organize your essay with an introduction, body paragraphs, and conclusion. Include a Works Cited page in proper MLA format. Maintain a formal, academic tone throughout your essay. Standard academic paragraphs are eight or more sentences (approx. 250 words each) You will not be able to use double-space in the textbox. 

Which type of cancer, based on the primary site affected, has the highest incidence rates  in the United States and Canada?