Here is a guide to what the following diagram means: K and L are both strands of double-stranded DNA. A, B, C, and D represent mRNA transcripts. E, F, J, and G are specific locations along strand K/L. H and I don’t refer to DNA at all; they refer to directions (the direction that the arrow is pointing).  What direction would be considered upstream? (This DNA is written according to standard conventions.) Image Description (Starting at the top and going down.) H with an arrow to the left and I with an arrow to the right. Double-stranded DNA: K GCCGTA(E)TAATGCATA(F)CATCA(J)TGCGACTTAGGGTTTCT(G)AAGTCAACAGTTATT K L CGGCAT(E)ATTACGTAT(F)GTAGT(J)ACGCTGAATCCCAAAGA(G)TTCAGTTGTCAATAA L mRNA transcripts: A GCCGUAUAAUGCAUACAUCAUGCGACUUAGGGUUUCUAAGUCAACAGUUAUU B CGGCAUAUUACGUAUGUAGUACGCUGAAUCCCAAAGAUUCAGUUGUCAAUAA C UUAUUGACAACUGAAUCUUUGGGAUUCAGCGUACUACAUACGUAAUAUGCCG D AAUAACUGUUGACUUAGAAACCCUAAGUCGCAUGAUGUAUGCAUUAUACGGC

Non-virulent bacteria can be prevented from being transformed into virulent bacteria if the debris from heat-killed virulent bacteria is first treated with ________.

Which of the following is not an essential element of cell communication?

Genetic diversity among organisms is increased by which process?

In which phase of the cell cycle is the DNA replicated?

CAR-T cell therapy only works on which of the following?

Mutations in which type of cells will not affect the individual and only affect the progeny?

Hershey and Chase performed an experiment with viruses and radioactive dye. What main conclusion did they come to?

Anabolic pathways of metabolism are pathways that ________.

If a mutation rendered the signal recognition particle nonfunctional, what would be the most obvious effect on the cell?