You are a doctor examining a patient’s blood test results. The patient’s T cell count is low, and T cells that are present are not well-developed. You are concerned that the patient will ________.

What are the major post-transcriptional modifications that happen to eukaryotic RNA before it is released as mRNA? (Mark all that apply.)

Chloroplasts have their own DNA. Which other organelle in a plant cell has its own DNA?

Leaves absorb the least amount of light in the ________ range of the visible spectrum.

Here is a guide to what the following diagram means: K and L are both strands of double-stranded DNA. A, B, C, and D represent mRNA transcripts. E, F, J, and G are specific locations along strand K/L. H and I don’t refer to DNA at all; they refer to directions (the direction that the arrow is pointing).  Where would the start codon be located along strand K/L? Image Description (Starting at the top and going down.) H with an arrow to the left and I with an arrow to the right. Double-stranded DNA: K GCCGTA(E)TAATGCATA(F)CATCA(J)TGCGACTTAGGGTTTCT(G)AAGTCAACAGTTATT K L CGGCAT(E)ATTACGTAT(F)GTAGT(J)ACGCTGAATCCCAAAGA(G)TTCAGTTGTCAATAA L mRNA transcripts: A GCCGUAUAAUGCAUACAUCAUGCGACUUAGGGUUUCUAAGUCAACAGUUAUU B CGGCAUAUUACGUAUGUAGUACGCUGAAUCCCAAAGAUUCAGUUGUCAAUAA C UUAUUGACAACUGAAUCUUUGGGAUUCAGCGUACUACAUACGUAAUAUGCCG D AAUAACUGUUGACUUAGAAACCCUAAGUCGCAUGAUGUAUGCAUUAUACGGC

An individual is born with a mutation such that they cannot form MAC proteins that associate with one another in a plasma membrane. This is an example of ________.

In the context of meiosis, homologous chromosomes can be defined as ________.

Paralytic shellfish syndrome can cause ___ due to saxitoxin, a potent neurotoxin. 

Which of the following accurately describes the path travelled by a new protein as it is synthesized and released from the cell?

What is genetic drift?