The process of using and transforming energy is known as: 

How would the mutation in the previous question change the polypeptide?

The mRNA has a three-nucleotide sequence called a _________, while the molecule transporting the amino acid has a complementary sequence called a(n) _______________. 

If one strand of a DNA molecule runs in a 5´à 3´, then the other strand will run in a __________ direction.

In a chemical reaction, the bonds of the __________ are broken and the atoms are rearranged to form the ___________.

What would happen, if anything, to the mRNA sequence if the A at position 13 on the DNA sequence was changed to a G by a point mutation?  Here’s the DNA sequence again: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’

Which of the following is a structural polysaccharide?

Which type of cell junction prevents cells from pulling apart when a tissue is bent or stretched?

Which of the following components is different between amino acids?

Materials move in and out of the nucleus through the __________.