the adding of bases to the 3′ hydroxyl by DNA polymerase III  best describes the [step] step of [process]

During which process are two gametes united to form a zygote?

Making protein from the information contained in mRNA is known as

For the following Free response consider this the template strand: 5′ CTTAGAGTCCTCAGTCCACGTGCATGT 3′

The major pigment used in photosynthesis is

DNA replication  is best described as

The site of glycolysis is the

The enzyme associated with transcription is

By which process do prokaryotic cells divide to produce two identical daughter cells?

Making a copy of DNA using a DNA template is known as