“Cold Play Corporation makes snowmobiles. Dale is injured when a defect unexpectedly accelerates the Cold Play vehicle he is driving, and he is thrown off. Esty, a hiker standing in the path of the unmanned vehicle, is struck and injured. In a suit based on strict product liability, Cold Play may be liable to”

The sequence below represents the complete mRNA for a very short gene.  5’ – ACUGGUAUGCAUAUCCUUCUAUGAACGUAA – 3  (wild type sequence)   A mutation has occurred – the A at position 11 has converted to a C 5’ – ACUGGUAUGCCUAUCCUUCUAUGAACGUAA – 3  (wild type sequence)   In your own words, describe what the consequence of this mutation would be for the amino acid sequence in the protein.  In your answer you should explain whether this is a missense, nonsense, frameshift, or silent mutation. 

In the Meselson–Stahl experiment (DNA replication), cells were first grown in media continihg ‘heavy’ nitrogen(N15 radioactive).  The cells were then switched to growth in media containing ‘light (normal N14, non radioactive). Which observation ruled out the conservative model of DNA replication?   

On the image of DNA below, which letter represents a 3′ end? 

Griffith’s transformation experiments demonstrated that combining heat-killed bacterium strain S (smooth capsule and lethal) with bacterium strain R (rough capsule and non-lethal) transformed strain R into the lethal strain S. Which of the following treatments before combining the two strains would provide evidence that DNA is the genetic material?

Find the indicated critical value. Z0.07 = [critical] MUST use Statcrunch

A survey is conducted to determine the percentage of students at state universities who change their major at least once. In a simple random sample of 150​ students, 88 indicated that they graduated with a different major from the one with which they entered college. Determine a​ 95% confidence interval for the percentage of students who change their major. Choose the correct answer. MUST use Statcrunch

Assume that adults have IQ scores that are normally distributed with a mean of 100 and a standard deviation of 20. What IQ score separates the top 14% of the population?  MUST use Statcrunch

It is believed that a certain percentage of U.S. homes have direct satellite television receivers. Your team of researchers wants to find out more about this. How large a sample is necessary to estimate the true population proportion of homes with direct satellite television receivers with 95​% confidence and within 4% points of the true population percentage? Complete parts​ (a) and​ (b) below. a. Assume that nothing is known about the percentage of homes who have a direct satellite television receiver. n= [a] b. Assume that a prior survey suggests that about 38​% of homes have a direct satellite television receiver. n= [b] MUST use Statcrunch

1.     What early American theatrical traditions helped shape the development of musical theatre, and which 1860s production is sometimes called the first American musical?